count source_label source_id relationship target_label target_id entity_type solr_id publication_id sentences 16 CHEBI:29108 activates AACS UNIPROT:Q86V21 Chemical 70100f4c-1b49-11f0-b759-0050569a791b 10.1016/j.ijggc.2024.104144 They concluded that the permeability of CO2and H2S in pozzolanic-modified cement with 35% content is relatively small, while the permeability in pozzolanic-modified cement with 65% content is relatively large, and the mechanical strength does not change significantly.Samarakoon et al. (2022)conducted material Characterization test on cement exposed to CO2-riched brine, and studied the carbonization law of low calcium high calcium base alkali activated cement (AACs) and G cement (GC) under high temperature and high pressure environment (HTHP). 16 MESH:D009538 decreases AACS UNIPROT:Q86V21 Phenotype d8e57f9a-3747-11e8-8636-001a4a160175 26776438 Thus, we speculated that prenatal nicotine exposure may decrease AACS expression to inhibit cholesterol supply in the fetal rat adrenals.|||These findings were in line with our hypothesis that prenatal nicotine exposure may inhibit AACS expression through increasing the DNA methylation rate in its promoter.|||These results exhibited that prenatal nicotine exposure markedly reduced the mRNA level of AACS to 15.6% of the control in fetal adrenals (P<0.05).|||DNA methylation rate of AACS promoter in fetal rat adrenals To verify whether the nicotine-induced decrease of AACS expression is related to CpG methylation changes, the proximal promoter of the rat AACS gene was selected for methylation analysis.|||The underlying mechanism may be that prenatal nicotine exposure can induce the DNA hypermethylation of AACS promoter and inhibit AACS expression in fetal adrenals, which could subsequently inhibit the cholesterol supply followed by the decreased production of steroid hormones and the increased IUGR rates. 8 AACS UNIPROT:Q86V21 activates MESH:D000255 Phenotype 2f049616-351f-11e8-9192-001a4a160175 PMC5313038 However, AcAc can be exported from mitochondria and utilized in anabolic pathways via conversion to AcAc-CoA by an ATP-dependent reaction catalyzed by cytoplasmic acetoacetyl-CoA synthetase (AACS,Figure 1B). 8 AACS UNIPROT:Q86V21 activates MESH:D007657 Phenotype 734872e0-001d-11f0-a3d5-0050569a1f61 10.1016/j.jpba.2024.116584 Inhibition of AACS expression partially inhibits glucose-induced insulin release[28], in addition to the fact that the enzyme encoded by AACS is a ketone body-utilizing ligase that plays a role in lipid synthesis through a non-oxidative pathway, and knockdown of AACS in vivo resulted in lower total blood cholesterol[29,30]. 8 UNIPROT:P01266 activates AACS UNIPROT:Q86V21 Protein caf46792-001d-11f0-9c09-0050569a791b 10.1016/j.foodchem.2024.142065 In addition, it should be noted that the addition of TG mainly promoted the formation of ketone AACs (2-nonanone and 2-undecanone) in HDS, and the ketones OAV accounted for 63.98 % of the total OAV of HDS-TG. 6 UNIPROT:Q99538 activates AACS UNIPROT:Q86V21 Protein e41a8308-3529-11e8-bf76-001a4a160175 25301556 On the other hand, co-transfection of AACS and legumain caused cleavage of AACS, mainly generating 55 and 45kDa bands (arrows) in western blotting.|||This cleavage was directly catalyzed by legumain, and knockdown of legumain in the kidney decreased the cleaved form of AACS and increased the intact form. 4 AACS UNIPROT:Q86V21 increases UNIPROT:P01308 Protein 734872e0-001d-11f0-a3d5-0050569a1f61 10.1016/j.jpba.2024.116584 Inhibition of AACS expression partially inhibits glucose-induced insulin release[28], in addition to the fact that the enzyme encoded by AACS is a ketone body-utilizing ligase that plays a role in lipid synthesis through a non-oxidative pathway, and knockdown of AACS in vivo resulted in lower total blood cholesterol[29,30]. 4 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical d8e57f9a-3747-11e8-8636-001a4a160175 26776438 Acetoacetyl-CoA can be produced directly from cytosolic acetoacetate by AACS, the rate-limiting enzyme for the utilization of ketones (Hasegawa et al., 2008; Narishima et al., 2009; Salam et al., 1989). 4 AACS UNIPROT:Q86V21 activates MESH:D002784 Phenotype 2f049616-351f-11e8-9192-001a4a160175 PMC5313038 Knockdown of AACS in mice in vivo decreased serum cholesterol (Hasegawa et al., 2012c). 4 AACS UNIPROT:Q86V21 inhibits MESH:D002784 Phenotype d8e57f9a-3747-11e8-8636-001a4a160175 26776438 Thus, we speculated that prenatal nicotine exposure may decrease AACS expression to inhibit cholesterol supply in the fetal rat adrenals. 4 AACS UNIPROT:Q86V21 inhibits MESH:D051379 Phenotype 46714e2e-352a-11e8-9192-001a4a160175 25592043 However, the percentages of CD80+and CD86+AACs were significantly reduced in the IGF-1 and IGF-2 highly-expressing WF-3 bearing mice compared with those in the WF-3 mock group after 35 days of tumor challenge (Fig. 7F). 4 AACS UNIPROT:Q86V21 inhibits GO:0006306 Phenotype d8e57f9a-3747-11e8-8636-001a4a160175 26776438 These findings were in line with our hypothesis that prenatal nicotine exposure may inhibit AACS expression through increasing the DNA methylation rate in its promoter. 4 AACS UNIPROT:Q86V21 activates UNIPROT:P55809 Protein 6440bd48-bc07-11e5-8abe-001a4ae51246 10.1016/j.bbaexp.2005.05.006 Effect of streptozotocin administration on the localization of AACS mRNA in rat brain Since we had observed that streptozotocin-induced diabetes resulted in a marked decrease in the AACS-specific activity in the liver of rats[8], the localization profile of AACS mRNA in the brain of streptozotocin-induced diabetic rats was compared to that of SCOT.|||Since we had observed that streptozotocin-induced diabetes resulted in a marked decrease in the AACS-specific activity in the liver of rats[8], the localization profile of AACS mRNA in the brain of streptozotocin-induced diabetic rats was compared to that of SCOT. 4 MESH:D009841 inhibits AACS UNIPROT:Q86V21 Phenotype d02cd0e2-f847-11e5-8bba-001a4ae51247 27021680 The oligonucleotide primers used for amplification were: forward (tccgcaaccatgtc caagct) and reverse (atcacatgcacagctggatg) for mouse AACS, forward (cgaagatggcggctctcaaa) and reverse (gatgcttcaagttgaaatct) for mouse SCOT, forward (agagtttgaccgccttccga) and reverse (gtcagccagacttcttcaga) for mouse HMGCR, forward (ccatggaggaggtggtgata) and reverse (cgtctcgggatctctgctaa) for mouse FAS, and forward (tgcaagagacttccatccag) and reverse (ttgccgagtagatctcaaag) for mouse IL-6. 4 MESH:D001865 inhibits AACS UNIPROT:Q86V21 Phenotype da529e36-cb8c-11e5-9498-001a4ae51246 10748262 Secondly, the mitochondrial AACs from all sources are specifically inhibited by the naturally occurring compounds bongkrekic acid, and carboxyatractylate[100]. 4 MESH:D009538 methylatesProtein AACS UNIPROT:Q86V21 Phenotype d8e57f9a-3747-11e8-8636-001a4a160175 26776438 Prenatal nicotine exposure induces hypermethylation of the AACS promoter in fetal rat adrenals It has been reported that AACS gene can be regulated at the level of transcription (Hasegawa et al., 2012, 2008).|||The underlying mechanism may be that prenatal nicotine exposure can induce the DNA hypermethylation of AACS promoter and inhibit AACS expression in fetal adrenals, which could subsequently inhibit the cholesterol supply followed by the decreased production of steroid hormones and the increased IUGR rates. 3 AACS UNIPROT:Q86V21 activates UNIPROT:P05231 Protein 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 aACs induced only a very short burst of IL-6, which was sufficient to abolish the protective TGF-β response.|||injection of 20 × 106ACs or aACs into naive mice confirmed that both aACs and ACs induced the production of IL-10 from splenocytes; however, aACs also increased the production of TNF-α and IL-6 (Fig. 2A).|||Inhibition of TLR4 had no significant effect on the production of IL-6 by aACs but could abolish the production of IL-6 induced by stimulation with LPS (Fig. 1C). 2 AACS UNIPROT:Q86V21 decreases UNIPROT:Q86V21 Protein d8e57f9a-3747-11e8-8636-001a4a160175 26776438 DNA methylation rate of AACS promoter in fetal rat adrenals To verify whether the nicotine-induced decrease of AACS expression is related to CpG methylation changes, the proximal promoter of the rat AACS gene was selected for methylation analysis. 2 AACS UNIPROT:Q86V21 activates UNIPROT:P22301 Protein 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 injection of 20 × 106ACs or aACs into naive mice confirmed that both aACs and ACs induced the production of IL-10 from splenocytes; however, aACs also increased the production of TNF-α and IL-6 (Fig. 2A). 2 AACS UNIPROT:Q86V21 increases UNIPROT:P22301 Protein 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 Whereas ACs and aACs induced equal amounts of IL-10 (Fig. 1A,1B), aACs preferentially enhanced the production of the inflammatory cytokines TNF-α and IL-6 (Fig. 1A,1B). 2 AACS UNIPROT:Q86V21 increases UNIPROT:P01308 Protein 1d6b3434-c8e6-11e5-9ad8-001a4ae51247 17724028 The use of shRNA to knock down the cytosolic enzymes ATP citrate lyase, which does not decrease insulin release, and acetoacetyl-CoA synthetase, which does cause a concomitant decrease in insulin release, supports the idea that acetoacetate may be very important as a carrier of short chain acyl groups from the mitochondria to the cytosol in the beta cell. 2 AACS UNIPROT:Q86V21 increases UNIPROT:Q8N3V7 Protein e41a8308-3529-11e8-bf76-001a4a160175 25301556 Previously, we showed that knockdown of AACS down-regulates the protein expression of synaptopodin in primary neurons[11]. 2 AACS UNIPROT:Q86V21 activates UNIPROT:P28347 Protein b8e3c696-cb2b-11e5-8189-001a4ae51246 PMC134887 "The AA product of this reaction is activated to acetoacetyl-CoA by the enzyme acetoacetyl-CoA synthetase (AACS; EC 6.2.1.16), encoded byacsA2inSinorhizobium meliloti(5,7,15)." 2 AACS UNIPROT:Q86V21 activates UNIPROT:Q14032 Protein 34dc9dbc-bc50-11e5-8d2d-001a4ae51247 PMC3478556 ICV OXM increased acetoacetyl-CoA synthetase (AACS) and fatty acid synthase (FASN) expression, suggesting that it stimulates lipogenesis in BAT. 2 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical 936ece36-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2012.09.076 However, it has been shown that acetoacetate is activated to its CoA ester by a cytosolic acetoacetate-specific ligase, acetoacetyl-CoA synthetase (AACS, acetoacetate-CoA ligase, EC 6.2.1.16), for the direct production of acetyl-CoA, which is then used for the synthesis of physiologically important lipidic substances, such as cholesterol and fatty acids, in the cytosol[11]. 2 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical 84489d58-352d-11e8-a34b-001a4a160175 29024632 AACS activates acetoacetate to acetoacetyl-CoA and the latter participates in fatty acid synthesis and cholesterol synthesis[26]. 2 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical 84489d58-352d-11e8-a34b-001a4a160175 29024632 AACS activates acetoacetate to acetoacetyl-CoA and the latter participates in fatty acid synthesis and cholesterol synthesis[26]. 2 AACS UNIPROT:Q86V21 activates GO:0008610 Phenotype 34dc9dbc-bc50-11e5-8d2d-001a4ae51247 PMC3478556 ICV OXM increased acetoacetyl-CoA synthetase (AACS) and fatty acid synthase (FASN) expression, suggesting that it stimulates lipogenesis in BAT. 2 AACS UNIPROT:Q86V21 activates GO:0009058 Phenotype c4605652-c95f-11ee-b346-0050569a791b 10.1016/j.jhazmat.2022.129877 ACSS1 and ALDH in the pyruvate pathway and AACS in leucine metabolism were significantly up-regulated, promoting the synthesis of acetyl-CoA that then entered the TCA cycle. 2 AACS UNIPROT:Q86V21 activates GO:0009058 Phenotype 0ae127f8-bbf6-11e5-8abe-001a4ae51246 PMC4561322 Acetoacetyl-CoA synthetase (AACS) can directly activate ketone bodies for the synthesis of physiologically important lipidic substances such as cholesterol and fatty acid [73]. 2 AACS UNIPROT:Q86V21 activates MESH:D002784 Phenotype d8e57f9a-3747-11e8-8636-001a4a160175 26776438 Prenatal nicotine exposure inhibits AACS-mediated cholesterol supply in fetal rat adrenals In rat adrenals, free cholesterol can be supplied by the hydrolysis of cellular stored CE, the uptake and subsequent metabolism of lipoprotein-derived CE, and the synthesis of cellular endogenous cholesterol (Hoekstra et al., 2008). 2 AACS UNIPROT:Q86V21 inhibits MESH:D003643 Phenotype a0f65ee6-c8eb-11e5-891f-001a4ae51247 18803669 The AACs also inhibit gp120-triggered death in human neuroblastoma cells [78] and cross the blood–brain barrier [78]. 2 AACS UNIPROT:Q86V21 activates MESH:D003643 Phenotype f055ea04-bc22-11e5-9b9d-001a4ae51247 10.1016/j.bbamem.2007.04.017 The AACs inhibit HIV-1 infection and proliferation in cultured human lymphocytes, displaying low cytotoxicity[5,7,11], inhibit gp120-triggered death in human neuroblastoma cells, and cross the blood brain barrier[11]. 2 AACS UNIPROT:Q86V21 activates MESH:D009765 Phenotype d02cd0e2-f847-11e5-8bba-001a4ae51247 27021680 Therefore, an activation of ketone body utilization by IL-6 might stimulate bone resorption, and AACS likely plays an important role for the relationship between osteoporosis and diet-induced obesity. 2 AACS UNIPROT:Q86V21 activates MESH:D007659 Phenotype 0ae127f8-bbf6-11e5-8abe-001a4ae51246 PMC4561322 Acetoacetyl-CoA synthetase (AACS) can directly activate ketone bodies for the synthesis of physiologically important lipidic substances such as cholesterol and fatty acid [73]. 2 AACS UNIPROT:Q86V21 inhibits MESH:D011041 Phenotype cb87d174-3385-11e8-9192-001a4a160175 26616220 It was noticed that the inhibition of AACs through atractyloside (ATR), which corresponds to the decarboxylated CATR, caused poisoning at physiological level[26–28]. 2 AACS UNIPROT:Q86V21 activates MESH:D007657 Phenotype 31ec55d4-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2005.07.053 On the other hand, in the cytosol, ketone body is known to be activated and incorporated into cholesterol and fatty acids by acetoacetyl-CoA synthetase (AACS, acetoacetate-CoA ligase, EC 6.2.1.16), which we purified for the first time from bacterium, Zoogloea ramigera I-16-M[2], and rat liver cytosol[3]. 2 AACS UNIPROT:Q86V21 activates MESH:D009447 Phenotype f055ea04-bc22-11e5-9b9d-001a4ae51247 10.1016/j.bbamem.2007.04.017 The AACs inhibit HIV-1 infection and proliferation in cultured human lymphocytes, displaying low cytotoxicity[5,7,11], inhibit gp120-triggered death in human neuroblastoma cells, and cross the blood brain barrier[11]. 2 AACS UNIPROT:Q86V21 activates MESH:D000105 Phenotype c4605652-c95f-11ee-b346-0050569a791b 10.1016/j.jhazmat.2022.129877 ACSS1 and ALDH in the pyruvate pathway and AACS in leucine metabolism were significantly up-regulated, promoting the synthesis of acetyl-CoA that then entered the TCA cycle. 2 AACS UNIPROT:Q86V21 activates MESH:D000105 Phenotype 6440bd48-bc07-11e5-8abe-001a4ae51246 10.1016/j.bbaexp.2005.05.006 Considering the intracellular localization of AACS, which could allow acetyl-CoA production directly from acetoacetate in the cytoplasmic compartment of the cells, it seems important to investigate the regulation of AACS activity in cholinergic neurons. 2 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical cb98b946-cb8e-11e5-8106-001a4ae51247 PMC111258 "meliloti, acetoacetyl-CoA synthetase is responsible for activation of acetoacetate, even in the presence of considerable levels of acetoacetate:succinyl-CoA transferase activity.|||This confirms thataau-7encodes acetoacetyl-CoA synthetase (acetoacetyl-CoA ligase; EC6.2.1.16), which activates acetoacetate to acetoacetyl-CoA by the single reaction ATP + CoA + acetoacetate =>acetoacetyl-CoA + AMP + PPi." 2 AACS UNIPROT:Q86V21 inhibits MESH:D001168 Phenotype 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 aACs are unable to suppress the development of inflammatory arthritis It has previously been shown that transfer of thymically derived ACs at the time of immunization can suppress the development and severity of inflammatory arthritis through the production of IL-10 (10,18).|||aACs are unable to suppress the development of inflammatory arthritis due to the induction of IL-6 and inhibition of TGF-β production We next sought to determine whether shifting the balance of proinflammatory and anti-inflammatory cytokines after aAC transfer could restore the protective immune response that was observed with ACs. 2 MESH:D013311 increases AACS UNIPROT:Q86V21 Phenotype 6440bd48-bc07-11e5-8abe-001a4ae51246 10.1016/j.bbaexp.2005.05.006 Streptozotocin treatment caused a remarkable decrease in AACS mRNA levels in all regions where expression was observed, and similar results were obtained for HMGCR mRNA but not for SCOT mRNA. 2 UNIPROT:Q86V21 decreases AACS UNIPROT:Q86V21 Protein d8e57f9a-3747-11e8-8636-001a4a160175 26776438 DNA methylation rate of AACS promoter in fetal rat adrenals To verify whether the nicotine-induced decrease of AACS expression is related to CpG methylation changes, the proximal promoter of the rat AACS gene was selected for methylation analysis. 2 UNIPROT:Q9Y324 inhibits AACS UNIPROT:Q86V21 Protein cb87d174-3385-11e8-9192-001a4a160175 26616220 It is worth noting that the CATR interacts directly with AACs proposed binding region[24], thus inhibiting AACs from the cytosolic face, whereas BKA is able to inhibit AACs from the matrix side[25]. 2 UNIPROT:A1CFK8 actelytatesProtein AACS UNIPROT:Q86V21 Protein e1f2a6d8-374e-11e8-87fd-001a4a160176 28034645 S.lividansencodes PatA as a KAT, which acetylates AacS efficiently and Acs only weakly[8]. 2 UNIPROT:P05231 increases AACS UNIPROT:Q86V21 Protein d02cd0e2-f847-11e5-8bba-001a4ae51247 27021680 Moreover, we revealed that AACS gene expression was significantly up-regulated by IL-6 treatment only in osteoclasts, but the number of TRAP-positive RAW 264 cells was not affected (Fig. 4A). 2 MESH:D009765 activates AACS UNIPROT:Q86V21 Phenotype d02cd0e2-f847-11e5-8bba-001a4ae51247 27021680 HFD-induced obesity increased the gene expression of AACS and IL-6 mRNA in osteoblasts Recently, several reports have suggested that diet-induced obesity triggers bone metabolic disorder[1–3]. 2 MESH:D001151 activates AACS UNIPROT:Q86V21 Phenotype aff225fe-4877-11f0-9ac3-0050569a1f61 10.1016/j.jclepro.2016.08.050 This means that it is the combination of intentional and unintentional uses of arsenic that drives the AACs depicted in the upper part ofFig. 2 CHEBI:30823 activates AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Oleate perfusion of livers from fed animals compared with perfusions without oleate increased AACS activity 2.2-fold while also increasing cytosolic HMG-CoA synthase 1.4-fold, cytosolic AcAc-CoA thiolase 2.2-fold, and HMG-CoA reductase 2.6-fold. 2 UNIPROT:P41159 increases AACS UNIPROT:Q86V21 Protein b87a19ea-bbdf-11e5-8abe-001a4ae51246 10.1016/j.neulet.2010.11.081 In addition, leptin significantly increased the levels of AACS gene in a dose-dependent manner (Fig. 2C).|||AACS mRNA expression was increased by leptin at concentrations above 1.25ng/ml (Fig. 3A). 2 UNIPROT:P08047 activates AACS UNIPROT:Q86V21 Protein 71dd531e-375a-11e8-a51f-001a4a160176 29137983 3A shows that knockdown of Sp1 reduced +104/-110 luciferase activity of AACS but not that of +104/-3. This result suggests that expression of Sp1 in critical for AACS promoter activity.|||These results suggest that the transcriptional activation of AACS by Sp1 has a crucial role in neuronal development. 2 UNIPROT:Q12772 increases AACS UNIPROT:Q86V21 Protein a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 These results suggest that AACS gene expression is upregulated by SREBP-2 in mice treated with hypocholesterolemic agents.|||Moreover, knockdown of SREBP-2 downregulated AACS and HMGCR gene expression (Fig. 5B). 2 MESH:D000105 inhibits AACS UNIPROT:Q86V21 Phenotype c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Palmitoyl-CoA (Ki= 9.8 μM), octanoyl-CoA (Ki= 17.0 μM), hexanoyl-CoA (Ki= 30 μM), butyryl-CoA (Ki= 190 μM), and Ac-CoA (Ki= 175 μM) all inhibited AACS noncompetitively (38).|||Also, if cytosolic Ac-CoA is in abundance produced from citrate by ACLY, this could affect the flux through AACS as high concentrations of Ac-CoA inhibit AACS (38). 1 AACS UNIPROT:Q86V21 activates UNIPROT:P10275 Protein 008c1910-c485-11e5-91a7-001a4ae51247 22700932 These results convergently indicated that AACs firing at high frequency could produce strong inhibition in the AIS of CA3 PCs during network activity. 1 AACS UNIPROT:Q86V21 inhibits UNIPROT:P04578 Protein a0f65ee6-c8eb-11e5-891f-001a4ae51247 18803669 So, AACs could be useful as inhibitors of gp120–CXCR4 binding without affecting CXCL12 chemotaxis activities. 1 AACS UNIPROT:Q86V21 inhibits UNIPROT:P48506 Protein 41c7a320-c6d1-11ee-b346-0050569a791b 10.1016/j.pneurobio.2023.102542 Since most transgenic strategies targeting PV neurons do not distinguish between subtypes, the net effect of such interventions would depend on how both AACs and BCs inhibit GCs. 1 AACS UNIPROT:Q86V21 decreases UNIPROT:P01130 Protein a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 Moreover, knockdown of AACS increased mRNA levels of HMGCR and LDLR (Fig. 6D). 1 AACS UNIPROT:Q86V21 increases UNIPROT:Q86V21 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 An AACS knockdown in mice, which utilized a short hairpin RNA that targeted mouseAacs, significantly reduced AACS expression and resulted in a decrease in total serum cholesterol of 28%. 1 AACS UNIPROT:Q86V21 activates UNIPROT:Q86V21 Protein 14c5b1ea-c6af-11ee-b346-0050569a791b 10.1016/j.ijbiomac.2023.126563 When the AACs complex with CDs, the stronger host-guest interaction between the AACs and CDs will cause the thermal evaporation of the AACs to shift to a higher temperature [103]. 1 AACS UNIPROT:Q86V21 inhibits UNIPROT:P05231 Protein 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 aACs are unable to suppress the development of inflammatory arthritis due to the induction of IL-6 and inhibition of TGF-β production We next sought to determine whether shifting the balance of proinflammatory and anti-inflammatory cytokines after aAC transfer could restore the protective immune response that was observed with ACs. 1 AACS UNIPROT:Q86V21 activates UNIPROT:Q8N3V7 Protein 936ece36-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2012.09.076 In addition, knockdown of AACS caused a marked reduction of synaptopodin (Fig. 4B), which is closely related to the formation of the spine apparatus and to hippocampal long-term potentiation[31]. 1 AACS UNIPROT:Q86V21 activates UNIPROT:P01375 Protein 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 injection of 20 × 106ACs or aACs into naive mice confirmed that both aACs and ACs induced the production of IL-10 from splenocytes; however, aACs also increased the production of TNF-α and IL-6 (Fig. 2A). 1 AACS UNIPROT:Q86V21 increases UNIPROT:Q01826 Protein 2474b02e-353b-11e9-ab56-001a4a160175 PMC5968071 As SATB1 is expressed by BCs and bistratified cells but not AACs in CA1 and CA3 (Viney et al.79), the results suggest that PV+ targets are AACs. 1 AACS UNIPROT:Q86V21 inhibits UNIPROT:Q9UKV0 Protein 71dd531e-375a-11e8-a51f-001a4a160176 29137983 Histone deacetylase 9 (HDAC9) mRNA levels were significantly decreased by knockdown of AACS. 1 AACS UNIPROT:Q86V21 increases UNIPROT:Q9UKV0 Protein 71dd531e-375a-11e8-a51f-001a4a160176 29137983 4showed that knockdown of AACS decreased mRNA levels of HDAC9 but not those of lipogenic enzymes. 1 AACS UNIPROT:Q86V21 increases UNIPROT:A6NFN3 Protein d118e6d3-950d-11eb-bff6-001a4a160176 PMCPMC8006298 Knockdown of AACS in primary neurons decreased the expression of MAP-2 and NeuN, two known markers of neuronal differentiation (Hasegawa et al., 2012). 1 AACS UNIPROT:Q86V21 increases UNIPROT:A6NFN3 Protein 936ece36-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2012.09.076 Moreover, knockdown of AACS significantly reduced the expression of NeuN, a marker of neural development, and slightly decreased the expression of MAP-2, a marker of dendritic outgrowth (Fig. 4B). 1 AACS UNIPROT:Q86V21 increases UNIPROT:P11137 Protein d118e6d3-950d-11eb-bff6-001a4a160176 PMCPMC8006298 Knockdown of AACS in primary neurons decreased the expression of MAP-2 and NeuN, two known markers of neuronal differentiation (Hasegawa et al., 2012). 1 AACS UNIPROT:Q86V21 decreases UNIPROT:P11137 Protein 936ece36-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2012.09.076 Moreover, knockdown of AACS significantly reduced the expression of NeuN, a marker of neural development, and slightly decreased the expression of MAP-2, a marker of dendritic outgrowth (Fig. 4B). 1 AACS UNIPROT:Q86V21 activates UNIPROT:Q9Y5Y9 Protein 34dc9dbc-bc50-11e5-8d2d-001a4ae51247 PMC3478556 Thus, the increased expression of LPL, AACS, and FASN after ICV OXM in WT mice further supports the role of SNS mediating the CNS–GLP-1R control of iBAT metabolism. 1 AACS UNIPROT:Q86V21 decreases UNIPROT:P04035 Protein a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 Moreover, knockdown of AACS increased mRNA levels of HMGCR and LDLR (Fig. 6D). 1 AACS UNIPROT:Q86V21 decreases UNIPROT:P04035 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 The AACS knockdown had increased mRNA levels of HMG-CoA reductase (18). 1 AACS UNIPROT:Q86V21 inhibits UNIPROT:P04608 Protein a0f65ee6-c8eb-11e5-891f-001a4ae51247 18803669 Furthermore, we found that the AACs antagonize some of the extracellular properties of Tat, such as increased viral production, induction of CXCR4 expression, suppression of CD3-activated proliferation of lymphocytes, and upregulation of the CD8 receptor [74], indicating that AACs and Tat bind to similar cellular targets. 1 AACS UNIPROT:Q86V21 activates CHEBI:16761 Chemical e864db8e-bc22-11e5-8abe-001a4ae51246 PMC2757529 AACs (also called ANTs for adenine nucleotide transporter) mediate the 1:1 exchange of ADP into and ATP out of the mitochondrial matrix across the inner membrane. 1 AACS UNIPROT:Q86V21 inhibits CHEBI:63596 Chemical 86169d82-bbeb-11e5-8abe-001a4ae51246 PMC3102446 AACs as Inhibitors of PchP subsection The PchP activity measured with variable concentrations ofp-NPP and variable concentrations of AAC in the presence of Mg2+indicated that all of the tested AACs were inhibitors of PchP with different degrees of efficiency (Table 2). 1 AACS UNIPROT:Q86V21 activates PUBCHEM:6816 Chemical cb98b946-cb8e-11e5-8106-001a4ae51247 PMC111258 "This confirms thataau-7encodes acetoacetyl-CoA synthetase (acetoacetyl-CoA ligase; EC6.2.1.16), which activates acetoacetate to acetoacetyl-CoA by the single reaction ATP + CoA + acetoacetate =>acetoacetyl-CoA + AMP + PPi." 1 AACS UNIPROT:Q86V21 activates CHEBI:30366 Chemical 0005abdc-bc47-11e5-9b9d-001a4ae51247 PMC2528576 AACs, or ANTs in human nomenclature, mediate the 1:1 exchange of ADPinand ATPoutacross the IM. 1 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical b001cbda-bbf5-11e5-9b9d-001a4ae51247 PMC2964118 Mitochondrial acetoacetate is exchanged against cytosolic puruvate (Kummel, 1983,1987) and activated by a cytosolic acetoacetyl-CoA synthetase (Bergstrom and Edmond, 1985). 1 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical 31ec55d4-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2005.07.053 These results suggest that direct activation of acetoacetate by AACS in the cytosolic compartment of the cells is an important step for the regulation of ketone body utilization on cholesterol and/or fatty acids biosynthesis. 1 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical 56350306-bc4f-11e5-8abe-001a4ae51246 PMC2884005 AACS activates acetoacetate as an acyl-AMP intermediate followed by ligation to the free thiol of CoA to form acetoacetyl-CoA (Fukui et al., 1982). 1 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical a1a3896a-c6c4-11ee-b346-0050569a791b 10.1186/s43141-023-00578-7 These findings suggest that acetoacetyl-CoA synthetase tends to activate acetoacetate to acetoacetyl-CoA in theS. 1 AACS UNIPROT:Q86V21 activates CHEBI:13705 Chemical f6719bc4-f910-11e5-a80d-001a4ae51247 PMC5041988 Stimulation of tyrosine degradation to fumarate and acetoacetate (terminal step catalyzed by FAH, Figure6), with ATP-dependent acetoacetate activation to acetoacetyl-CoA by AACS (not shown in Figure6), may occur due to SP-induced increase in tyrosine transamination with accumulated 2-oxoglutarate, catalyzed by TAT (Figure6). 1 AACS UNIPROT:Q86V21 actelytatesProtein CHEBI:51142 Chemical a7916440-bbf7-11e5-8abe-001a4ae51246 PMC4449854 The APHs and ANTs are the bisubstrate enzymes, which facilitate the transfer of the γ-phosphate and nucleotide monophosphate, respectively, from a nucleotide substrate to the hydroxyl groups of aminoglycoside antibiotics, while AACs acetylate amino groups derived from Acetyl Coenzyme A (acetyl-CoA) (6). 1 AACS UNIPROT:Q86V21 actelytatesProtein CHEBI:51142 Chemical 12c461ee-c47d-11e5-91a7-001a4ae51247 PMC2849353 "The APHs and ANTs are the bisubstrate enzymes that facilitate transfer of the γ-phosphate and nucleotide monophosphate, respectively, from a nucleotide substrate to the hydroxyl groups of aminoglycoside antibiotics, while AACs acetylate amino groups derived from acetyl coenzyme A (acetyl-CoA) (11,15,21)." 1 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical a6fdeec0-374e-11e8-b868-001a4a160176 PMC5596199 TheacsA2-encoded acetoacetyl-CoA synthetase (EC 6.2.1.16) then catalyzes the activation of acetoacetate to acetoacetyl-CoA for use in the pathway again (14). 1 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical cb98b946-cb8e-11e5-8106-001a4ae51247 PMC111258 "This confirms thataau-7encodes acetoacetyl-CoA synthetase (acetoacetyl-CoA ligase; EC6.2.1.16), which activates acetoacetate to acetoacetyl-CoA by the single reaction ATP + CoA + acetoacetate =>acetoacetyl-CoA + AMP + PPi." 1 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 Therefore, the production of acetoacetyl-CoA by AACS is an alternative pathway in the cytosolic cholesterol biosynthesis. 1 AACS UNIPROT:Q86V21 activates CHEBI:15345 Chemical 2acac424-bc10-11e5-8abe-001a4ae51246 10.1263/jbb.101.501 Released 3HB is converted to acetoacetate by 3HB dehydrogenase (BDH; EC 1.1.1.30), and activated to acetoacetyl-CoA by succinyl-CoA transferase (EC 2.8.3.5) or acetoacetyl-CoA synthetase (EC 6.2.1.16). 1 AACS UNIPROT:Q86V21 activates GO:0006810 Phenotype 49df88de-bc0d-11e5-9b9d-001a4ae51247 PMC3355511 coliand thylakoids is opposite to the direction of transport by mitochondrial AACs (Thuswaldner et al.,2007). 1 AACS UNIPROT:Q86V21 inhibits GO:0008610 Phenotype 36ee40de-bbff-11e5-9b9d-001a4ae51247 PMC2694693 In KIKO skeletal muscle and liver, our results indicate thatPgc1aactivity is downregulated, as shown by the increased expression in both tissues of a set of genes involved in lipogenesis that are normally repressed by Pgc1a, includingAcas2,Scd2,Acly,Aacs,Elovl3. 1 AACS UNIPROT:Q86V21 activates GO:0032635 Phenotype 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 Taken together, these results suggest that resting ACs suppress inflammation via TGF-β, whereas aACs promote IL-6 production, which blocks TGF-β production and its anti-inflammatory effects. 1 AACS UNIPROT:Q86V21 inhibits GO:0099610 Phenotype 41c7a320-c6d1-11ee-b346-0050569a791b 10.1016/j.pneurobio.2023.102542 Together these physiological features of dentate AACs and their extensive apical dendritic arbors, make them ideally suited to sense afferent excitability, respond reliably during high input activation, and inhibit action potential initiation by projection neurons, as has been reported in response to whisker stimulation in the barrel cortex (Zhu et al., 2004). 1 AACS UNIPROT:Q86V21 activates GO:1902224 Phenotype a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 These results suggest that AACS-mediated ketone body metabolism is an important reaction for cholesterol homeostasis. 1 AACS UNIPROT:Q86V21 inhibits GO:0008283 Phenotype fc513ce6-bbff-11e5-9b9d-001a4ae51247 10.1016/j.bbrc.2003.11.011 The AACs inhibit HIV-1 infection and proliferation in cultured human lymphocytes, displaying low cytotoxicity[32,34,36,37]. 1 AACS UNIPROT:Q86V21 activates MESH:D002784 Phenotype a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 AACS protein expression was significantly reduced following tail-vein injection of the shRNA vector directed against AACS mRNA, and the knockdown of AACS significantly reduced the total blood cholesterol (Fig. 6B). 1 AACS UNIPROT:Q86V21 activates MESH:D002784 Phenotype 0f4d166e-c464-11e5-91a7-001a4ae51247 PMC3625904 Genetic knockdown of AACS in mouse liver lowered total blood cholesterol in vivo, and in vitro AACS knockdown impaired differentiation of primary mouse embryonic neurons and inhibited adipocyte differentiation of 3T3-L1 cells [(79–81), also seeReversibility of the CoA Transferase Reaction Extends Cardiovascular Disease Targets of Ketone Body Metabolism]. 1 AACS UNIPROT:Q86V21 activates GO:0045444 Phenotype 0f4d166e-c464-11e5-91a7-001a4ae51247 PMC3625904 Genetic knockdown of AACS in mouse liver lowered total blood cholesterol in vivo, and in vitro AACS knockdown impaired differentiation of primary mouse embryonic neurons and inhibited adipocyte differentiation of 3T3-L1 cells [(79–81), also seeReversibility of the CoA Transferase Reaction Extends Cardiovascular Disease Targets of Ketone Body Metabolism]. 1 AACS UNIPROT:Q86V21 activates GO:0006695 Phenotype 936ece36-bc00-11e5-8abe-001a4ae51246 10.1016/j.bbrc.2012.09.076 These results suggest that AACS contributes to cholesterol synthesis in the embryo and has an important role in neurogenesis, especially dendritic outgrowth. 1 AACS UNIPROT:Q86V21 inhibits MESH:D012343 Phenotype ee507684-bc40-11e5-9b9d-001a4ae51247 10.1016/j.carres.2013.02.003 In this context it could be shown, that arginine–aminoglycoside conjugates (AACs) can enhance the inhibition of prokaryotic transfer RNA maturation by large extent, preventing the recognition of the peptidic and RNA-subdomain.4,5 In a seminal paper series by Lapidot and Litovchik it was demonstrated that guanidinylated aminoglycosides3,6, and7can discriminate between different pro- and eukaryotic RNAs making them suitable for inhibiting the prokaryotic counterpart exclusively.6Among these, the arginine-modified congeners3and7displayed better inhibition rates compared to6, which has been ascribed to the higher flexibilities of the guanidinylated side arms. 1 AACS UNIPROT:Q86V21 activates MESH:D000255 Phenotype 72e5d90c-34f2-11e9-9cf0-001a4a160175 PMC6240706 Indeed, AcAc can also directly generate a cytosolic pool of acetyl-CoA through an ATP-dependent reaction catalyzed by acetoacetyl-CoA synthetase (AACS), an enzyme whose gene is significantly more induced in SCOT KO BMDMs than in wild-type (WT) BMDMs (Figures 5A andS5A) (Puchalska et al., 2018). 1 AACS UNIPROT:Q86V21 activates MESH:D000255 Phenotype e6ed8356-b024-11ee-a19b-0050569a791b 10.1007/s10811-020-02128-x In another study, to increase acetoacetyl-CoA level, ATP-driven malonyl-CoA synthesis and decarboxylation by acetoacetyl-CoA synthetase were introduced intoSynechococcus7942. 1 AACS UNIPROT:Q86V21 activates MESH:D000255 Phenotype f6719bc4-f910-11e5-a80d-001a4ae51247 PMC5041988 Stimulation of tyrosine degradation to fumarate and acetoacetate (terminal step catalyzed by FAH, Figure6), with ATP-dependent acetoacetate activation to acetoacetyl-CoA by AACS (not shown in Figure6), may occur due to SP-induced increase in tyrosine transamination with accumulated 2-oxoglutarate, catalyzed by TAT (Figure6). 1 AACS UNIPROT:Q86V21 inhibits MESH:D007239 Phenotype fc513ce6-bbff-11e5-9b9d-001a4ae51247 10.1016/j.bbrc.2003.11.011 The AACs inhibit HIV-1 infection and proliferation in cultured human lymphocytes, displaying low cytotoxicity[32,34,36,37]. 1 AACS UNIPROT:Q86V21 inhibits MESH:D007657 Phenotype b87a19ea-bbdf-11e5-8abe-001a4ae51246 10.1016/j.neulet.2010.11.081 Thus, it is likely that the deficiency of leptin signaling induces AMPK activation in the Arc, which leads to suppression of the ketone body utilization in hypothalamic neurons by AACS. 1 AACS UNIPROT:Q86V21 activates GO:2001295 Phenotype e6ed8356-b024-11ee-a19b-0050569a791b 10.1007/s10811-020-02128-x In another study, to increase acetoacetyl-CoA level, ATP-driven malonyl-CoA synthesis and decarboxylation by acetoacetyl-CoA synthetase were introduced intoSynechococcus7942. 1 AACS UNIPROT:Q86V21 inhibits MESH:D002470 Phenotype aae9ac65-2643-11ea-8643-001a4a160176 PMC6982812 Yan, F et al. [24] revealed that AACS can reduce cell viability by causing cell membrane rupture or increased permeability, thereby facilitating PI entry into cells and binding to nucleic acids. 1 AACS UNIPROT:Q86V21 inhibits MESH:D012421 Phenotype aae9ac65-2643-11ea-8643-001a4a160176 PMC6982812 Yan, F et al. [24] revealed that AACS can reduce cell viability by causing cell membrane rupture or increased permeability, thereby facilitating PI entry into cells and binding to nucleic acids. 1 AACS UNIPROT:Q86V21 inhibits MESH:D009447 Phenotype a0f65ee6-c8eb-11e5-891f-001a4ae51247 18803669 The AACs also inhibit gp120-triggered death in human neuroblastoma cells [78] and cross the blood–brain barrier [78]. 1 AACS UNIPROT:Q86V21 activates GO:0032613 Phenotype 772c7ea8-bc19-11e5-9b9d-001a4ae51247 PMC4319310 IL-10 production by splenocytes was upregulated by aACs to a similar level observed by resting ACs (Fig. 3B,3D). 1 AACS UNIPROT:Q86V21 activates PF:PF01877 ProteinFamily a0f65ee6-c8eb-11e5-891f-001a4ae51247 18803669 All these findings suggest that the affinity of AACs and APACs for their RNA and protein targets can be enhanced synergistically by fusing two different functionalities capable of RNA binding and positively charged protein binding (i.e. aminoglycosides and arginine-rich peptides). 1 AACS UNIPROT:Q86V21 inhibits FPLX:PI3K ProteinFamily aae9ac65-2643-11ea-8643-001a4a160176 PMC6982812 Yan, F et al. [24] revealed that AACS can reduce cell viability by causing cell membrane rupture or increased permeability, thereby facilitating PI entry into cells and binding to nucleic acids. 1 AACS UNIPROT:Q86V21 inhibits PF:PF07670 ProteinFamily 41c7a320-c6d1-11ee-b346-0050569a791b 10.1016/j.pneurobio.2023.102542 Thus, AACs are in a privileged position to support the dentate inhibitory gate and limit dentate throughput during re-entrant seizure-like activity. 1 AACS UNIPROT:Q86V21 inhibits IP:IPR028555 ProteinFamily 34efa728-c8e8-11e5-9624-001a4ae51246 PMC1899997 "One possibility is that there is a second Ras GEF that is selectively inhibited by SUR-5 and, under some conditions, may be able to feed into the Ras pathway (35) (Fig.6)." 1 AACS UNIPROT:Q86V21 inhibits FPLX:RAS ProteinFamily 43a7b098-cc13-11e5-83a8-001a4ae51246 PMC109041 By one mechanism, SUR-5(+) protein may suppress LET-60 Ras(+) activity (e.g., it may directly suppress its ability to bind to an effector or may suppress the expression of the effector); loss ofsur-5activity may result in an increase of LET-60 Ras(+) activity that either competes better with the LET-60 Ras(dn) for the activator or becomes less dependent on the activator. 1 CHEBI:17234 activates AACS UNIPROT:Q86V21 Chemical 509558ee-d517-11ee-b346-0050569a791b 10.1007/s00572-018-0828-x Auxofuran have same target with glucose that activates acetoacyl-CoA synthetase gene (Aacs) which is associated with ergosterol synthesis, an important component of cell structure (Schrey et al.43). 1 CHEBI:30769 inhibits AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 If bempedoyl-CoA does inhibit AACS, bempedoic acid would be an inhibitor of both the AcAc and the citrate pathways for denovo lipid synthesis. 1 UNIPROT:Q86V21 increases AACS UNIPROT:Q86V21 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 An AACS knockdown in mice, which utilized a short hairpin RNA that targeted mouseAacs, significantly reduced AACS expression and resulted in a decrease in total serum cholesterol of 28%. 1 UNIPROT:Q86V21 activates AACS UNIPROT:Q86V21 Protein 14c5b1ea-c6af-11ee-b346-0050569a791b 10.1016/j.ijbiomac.2023.126563 When the AACs complex with CDs, the stronger host-guest interaction between the AACs and CDs will cause the thermal evaporation of the AACs to shift to a higher temperature [103]. 1 UNIPROT:P41143 activates AACS UNIPROT:Q86V21 Protein 63f7cca0-bbd5-11e5-8abe-001a4ae51246 PMC4159373 In one case the isolated strain produced AmpC β-lactamases, decreased OprD porin expression, and upregulation of MexXY efflux.116Another strain produced an MBL, AmpC β-lactamase, and two aminoglycoside acetylating enzymes (AACs).117 MDR Acinetobacter ResistantP. 1 UNIPROT:P11532 activates AACS UNIPROT:Q86V21 Protein 41c7a320-c6d1-11ee-b346-0050569a791b 10.1016/j.pneurobio.2023.102542 Given the relatively sparse distribution of IML PV neurons (2–3 cells/ section), DMD-based single neuron stimulation using a 50 µm ROI over the somata of isolated eYFP labeled IML neurons was used to activate individual AACs (see methods). 1 UNIPROT:Q9Y276 inhibits AACS UNIPROT:Q86V21 Protein 0313f1c6-bc15-11e5-8abe-001a4ae51246 PMC4270094 The early firing of BCs is expected to inhibit the later-discharging AACs and Bistrat cells as well, likely contributing to their relatively lower frequencies of firing during ripples. 1 CHEBI:15517 inhibits AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Palmitoyl-CoA (Ki= 9.8 μM), octanoyl-CoA (Ki= 17.0 μM), hexanoyl-CoA (Ki= 30 μM), butyryl-CoA (Ki= 190 μM), and Ac-CoA (Ki= 175 μM) all inhibited AACS noncompetitively (38). 1 MESH:D002784 inhibits AACS UNIPROT:Q86V21 Phenotype a6e896f6-bc1c-11e5-9b9d-001a4ae51247 10.1016/j.ymgme.2012.08.017 In addition, AACS activity is dramatically induced by hypocholesterolemic agents and reduced by dietary cholesterol in the rat liver[7,10]. 1 UNIPROT:P09923 activates AACS UNIPROT:Q86V21 Protein 52449a5a-c8de-11ee-8b99-0050569a1f61 10.1016/j.anorl.2022.06.006 CP can lead to acute abdominal compartment syndrome (AACS), with cardiorespiratory decompensation, by increased intra-abdominal pressure (IAP), compressing the inferior vena cava and diaphragm. 1 UNIPROT:P41159 activates AACS UNIPROT:Q86V21 Protein 44e50850-3388-11e8-b868-001a4a160176 27000556 Indeed, central leptin signaling may be involved in the effect of ketone bodies on hypothalamic neurons (Narishima et al., 2011), as acetoacetyl-CoA synthetase, a ketone body utilizing enzyme, is induced by leptin in the arcuate nucleus and VMH but not in other brain regions, through the suppression of AMPK activity (Narishima et al., 2011). 1 UNIPROT:P41159 decreases AACS UNIPROT:Q86V21 Protein b87a19ea-bbdf-11e5-8abe-001a4ae51246 10.1016/j.neulet.2010.11.081 Since leptin binds to the leptin receptor in these cells, it is possible that the AACS mRNA levels in Arc and VMH are decreased by the loss of leptin function inob/obanddb/dbgenetically obese mice. 1 UNIPROT:Q9Y4P9 activates AACS UNIPROT:Q86V21 Protein 41c7a320-c6d1-11ee-b346-0050569a791b 10.1016/j.pneurobio.2023.102542 Since uIPSC parameters in response to optical and current clamp activation of AACs were similar, we pooled uIPSCs evoked by optical stimulation (17/20 pairs in control; 6/10 pairs post-SE) and current injections under whole cell configuration (3/20 pairs in control; 4/10 pairs in post-SE) for analysis. 1 UNIPROT:O75469 activates AACS UNIPROT:Q86V21 Protein 09708666-bbf6-11e5-8abe-001a4ae51246 PMC4421101 Mueller et al. [31] found that the induction of CYP2b10, CYP3a11, CDC20, and Cdk1 depend on both CAR and PXR, but AACS enzyme is only inducted by the PXR. 1 UNIPROT:P49715 increases AACS UNIPROT:Q86V21 Protein c2d93fe4-bbe2-11e5-9b9d-001a4ae51247 10.1016/j.bbagrm.2008.05.001 In this study, we demonstrated that C/EBPα induced the expression of AACS during the conversion period of 3T3-L1 preadipocytes into adipocytes (Figs. 1 UNIPROT:P49327 inhibits AACS UNIPROT:Q86V21 Protein 5601cb0e-bc49-11e5-8d2d-001a4ae51247 PMC3591534 The observed inverse correlation between the magnitude of changes in AACS expression with changes in concentration of metabolites in cluster-2A (Fig. S4-2a in the “Electronic Supplementary Material”) suggests that FASN inhibition by orlistat in NSCLC cells induces compensatory up-regulation of AACS to satisfy the increasing demand for FA. 1 MESH:D010171 inhibits AACS UNIPROT:Q86V21 Phenotype c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Palmitoyl-CoA (Ki= 9.8 μM), octanoyl-CoA (Ki= 17.0 μM), hexanoyl-CoA (Ki= 30 μM), butyryl-CoA (Ki= 190 μM), and Ac-CoA (Ki= 175 μM) all inhibited AACS noncompetitively (38). 1 CHEBI:50114 inhibits AACS UNIPROT:Q86V21 Chemical c8e3e0fc-3547-11e8-bf76-001a4a160175 18222430 Acetoacetyl-CoA synthetase, SCD1, FAS, ACC1, FADS1, and PPARG were decreased by estrogen in 5 or 6 individuals (Table 1A). 1 CHEBI:53218 inhibits AACS UNIPROT:Q86V21 Chemical 63f7cca0-bbd5-11e5-8abe-001a4ae51246 PMC4159373 In one case the isolated strain produced AmpC β-lactamases, decreased OprD porin expression, and upregulation of MexXY efflux.116Another strain produced an MBL, AmpC β-lactamase, and two aminoglycoside acetylating enzymes (AACs).117 MDR Acinetobacter ResistantP. 1 UNIPROT:P05231 activates AACS UNIPROT:Q86V21 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 AACS mRNA is found in mouse bone osteoclasts and induced by obesity and/or IL-6 (39). 1 UNIPROT:P08047 increases AACS UNIPROT:Q86V21 Protein 71dd531e-375a-11e8-a51f-001a4a160176 29137983 Moreover,Fig. 3B showed that overexpression of Sp1 significantly up-regulated AACS mRNA levels. 1 CHEBI:78510 decreases AACS UNIPROT:Q86V21 Chemical b87a19ea-bbdf-11e5-8abe-001a4ae51246 10.1016/j.neulet.2010.11.081 In contrast, AMPK inhibitor, compound C, markedly enhanced the mRNA level of AACS and slightly increased that of SCOT (Fig. 4, right panels). 1 MESH:D051379 increases AACS UNIPROT:Q86V21 Phenotype c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 An AACS knockdown in mice, which utilized a short hairpin RNA that targeted mouseAacs, significantly reduced AACS expression and resulted in a decrease in total serum cholesterol of 28%. 1 MESH:D009765 activates AACS UNIPROT:Q86V21 Phenotype c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 AACS mRNA is found in mouse bone osteoclasts and induced by obesity and/or IL-6 (39). 1 UNIPROT:Q13085 inhibits AACS UNIPROT:Q86V21 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 If bempedoyl-CoA does inhibit AACS, bempedoic acid would be an inhibitor of both the AcAc and the citrate pathways for denovo lipid synthesis. 1 MESH:D001019 activates AACS UNIPROT:Q86V21 Phenotype bdb91a9f-f531-11eb-b7c2-001a4a160176 PMC7471188 Among them, AACs caused by aortic rupture are relatively rare, but they are severe conditions with high mortality. 1 CHEBI:27540 inhibits AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Palmitoyl-CoA (Ki= 9.8 μM), octanoyl-CoA (Ki= 17.0 μM), hexanoyl-CoA (Ki= 30 μM), butyryl-CoA (Ki= 190 μM), and Ac-CoA (Ki= 175 μM) all inhibited AACS noncompetitively (38). 1 CHEBI:15533 inhibits AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 Palmitoyl-CoA (Ki= 9.8 μM), octanoyl-CoA (Ki= 17.0 μM), hexanoyl-CoA (Ki= 30 μM), butyryl-CoA (Ki= 190 μM), and Ac-CoA (Ki= 175 μM) all inhibited AACS noncompetitively (38). 1 PF:PF00803 activates AACS UNIPROT:Q86V21 ProteinFamily 71dd531e-375a-11e8-a51f-001a4a160176 29137983 3A shows that knockdown of Sp1 reduced +104/-110 luciferase activity of AACS but not that of +104/-3. This result suggests that expression of Sp1 in critical for AACS promoter activity. 1 MESH:D000617 inhibits AACS UNIPROT:Q86V21 Phenotype 019dc06e-f5b2-11eb-9f5f-001a4a160176 PMC6724535 Recently, Cox and coworkers[8]performed a detailed investigation of the vulnerability of plazomicin to clinically relevant aminoglycoside inactivating enzymes and ribosomal methyltransferases in a panel of isogenicEscherichia colistrains.Plazomicin is a semisynthetic aminoglycoside derived from sisomicin and is designed to chemically block the sites of chemical modification by aminoglycoside inactivating enzymes, includingN-acetyltransferases (AACs),O-nucleotidylyltransferases, andO-phosphotransferases (APHs)[9,10]. 1 UNIPROT:Q12772 decreases AACS UNIPROT:Q86V21 Protein bca108ce-20e5-11e6-a85d-001a4ae51246 PMC4855004 Hasegawa et al. [13] demonstrated that the AACS gene, which encodes the ketone body-utilizing enzyme, is transcriptionally regulated by SREBP-2 and the knockdown of SREBP-2 induced downregulation of AACS and HMGCR gene expression. 1 UNIPROT:A0R3F9 activates AACS UNIPROT:Q86V21 Protein ef079dc0-c46d-11e5-85e4-001a4ae51246 PMC4135648 "TheSePat homologue ofStreptomyces lividans(SlPatA) has protein acetyltransferase activity that modulates the activity of the acetoacetyl-CoA synthetase enzyme of this bacterium (6)." 1 MESH:D006851 activates AACS UNIPROT:Q86V21 Phenotype e864db8e-bc22-11e5-8abe-001a4ae51246 PMC2757529 Although not yet thoroughly investigated, four observations suggest that the ability of CL to activate AACs is not a yeast-specific phenomenon. 1 UNIPROT:P55042 activates AACS UNIPROT:Q86V21 Protein bdb91a9f-f531-11eb-b7c2-001a4a160176 PMC7471188 Most frequently, AACs are caused by rAA and rAD. 1 UNIPROT:P04035 inhibits AACS UNIPROT:Q86V21 Protein c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 With 4-aminopyrazolopyrimide treatment, rat adrenal AACS activity increased 7.3-fold and HMG-CoA reductase activity increased 15-fold demonstrating regulation of AACS activity in adrenals by its need for cholesterol (4). 1 CHEBI:42977 inhibits AACS UNIPROT:Q86V21 Chemical c5557776-c7b7-11ee-b346-0050569a791b PMC10388205 AACS activity in isolated rat hepatocytes was suppressed by 25-hydroxycholesterol in parallel with HMG-CoA reductase (30). 1 CHEBI:15345 inhibits AACS UNIPROT:Q86V21 Chemical cb98b946-cb8e-11e5-8106-001a4ae51247 PMC111258 "The increased concentration of acetoacetyl-CoA might inhibit the activity of acetoacetyl-CoA synthetase activity in vivo while not affecting acetoacetyl-CoA synthetase activity as measured in vitro." 1 UNIPROT:P01106 activates AACS UNIPROT:Q86V21 Protein 906c322e-bbfa-11e5-8abe-001a4ae51246 PMC3766375 Myc-induced temporal activation of lipogenic genes, including acetoacetyl-CoA synthetase (AACS) and ACLY was also observed[134]. 1 FPLX:Porins activates AACS UNIPROT:Q86V21 ProteinFamily 63f7cca0-bbd5-11e5-8abe-001a4ae51246 PMC4159373 In one case the isolated strain produced AmpC β-lactamases, decreased OprD porin expression, and upregulation of MexXY efflux.116Another strain produced an MBL, AmpC β-lactamase, and two aminoglycoside acetylating enzymes (AACs).117 MDR Acinetobacter ResistantP. 1 CHEBI:73498 actelytatesProtein AACS UNIPROT:Q86V21 Chemical 5c4dcd52-c47b-11e5-9da3-001a4ae51247 PMC3116390 "UV-Visible (UV-Vis) and mass spectrometry assays of these six AACs with the ten AGs that are multiacetylated by Eis, showed only monoacetylation."